grna cas9 expression vector made in (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
grna cas9 expression vector made in
Grna Cas9 Expression Vector Made In, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4086 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+gfp+expression+plasmid/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/bio_rxiv__64898__2026__03__27__714694-254-9-21
Average 96 stars, based on 4086 article reviews
Grna Cas9 Expression Vector Made In, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4086 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+gfp+expression+plasmid/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/bio_rxiv__64898__2026__03__27__714694-254-9-21
Average 96 stars, based on 4086 article reviews
grna cas9 expression vector made in - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Mitochondrial and Redox Modifications in Huntington Disease Induced Pluripotent Stem Cells Rescued by CRISPR/Cas9 CAGs Targeting Article Snippet: .. The sgRNA plasmid and a Article Title: SNX9-induced membrane tubulation regulates CD28 cluster stability and signalling Article Snippet: .. Briefly, Jurkat T cells were transfected with two guide RNAs designed using the GPP sgRNA Designer (https://portals. broadinstitute.org/gpp/public/analysis-tools/sgrna-design) to target exon 2: AATGAACTGACGGTTAATGA and exon 3: GAAACATCAAAGGAGAACGA of the SNX9 genomic DNA sequence, together with Article Title: SNX9-induced membrane tubulation regulates CD28 cluster stability and signalling Article Snippet: .. Briefly, Jurkat T cells were transfected with two guide RNAs designed using the GPP sgRNA Designer ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ) to target exon 2: AATGAACTGACGGTTAATGA and exon 3: GAAACATCAAAGGAGAACGA of the SNX9 genomic DNA sequence, together with Article Title: Pioneer activity distinguishes activating from non‐activating SOX2 binding sites Article Snippet: .. CRISP‐Cas9 and a sgRNA targeting the locus was cloned into a Article Title: Pioneer activity distinguishes activating from non-activating SOX2 binding sites. Article Snippet: .. CRISP-Cas9 and a sgRNA targeting the locus was cloned into a Expressing:Article Title: Mitochondrial and Redox Modifications in Huntington Disease Induced Pluripotent Stem Cells Rescued by CRISPR/Cas9 CAGs Targeting Article Snippet: .. The sgRNA plasmid and a Article Title: SNX9-induced membrane tubulation regulates CD28 cluster stability and signalling Article Snippet: .. Briefly, Jurkat T cells were transfected with two guide RNAs designed using the GPP sgRNA Designer (https://portals. broadinstitute.org/gpp/public/analysis-tools/sgrna-design) to target exon 2: AATGAACTGACGGTTAATGA and exon 3: GAAACATCAAAGGAGAACGA of the SNX9 genomic DNA sequence, together with Article Title: SNX9-induced membrane tubulation regulates CD28 cluster stability and signalling Article Snippet: .. Briefly, Jurkat T cells were transfected with two guide RNAs designed using the GPP sgRNA Designer ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ) to target exon 2: AATGAACTGACGGTTAATGA and exon 3: GAAACATCAAAGGAGAACGA of the SNX9 genomic DNA sequence, together with Article Title: Pioneer activity distinguishes activating from non‐activating SOX2 binding sites Article Snippet: .. CRISP‐Cas9 and a sgRNA targeting the locus was cloned into a Article Title: Pioneer activity distinguishes activating from non-activating SOX2 binding sites. Article Snippet: .. CRISP-Cas9 and a sgRNA targeting the locus was cloned into a Transfection:Article Title: SNX9-induced membrane tubulation regulates CD28 cluster stability and signalling Article Snippet: .. Briefly, Jurkat T cells were transfected with two guide RNAs designed using the GPP sgRNA Designer (https://portals. broadinstitute.org/gpp/public/analysis-tools/sgrna-design) to target exon 2: AATGAACTGACGGTTAATGA and exon 3: GAAACATCAAAGGAGAACGA of the SNX9 genomic DNA sequence, together with Article Title: SNX9-induced membrane tubulation regulates CD28 cluster stability and signalling Article Snippet: .. Briefly, Jurkat T cells were transfected with two guide RNAs designed using the GPP sgRNA Designer ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ) to target exon 2: AATGAACTGACGGTTAATGA and exon 3: GAAACATCAAAGGAGAACGA of the SNX9 genomic DNA sequence, together with Sequencing:Article Title: SNX9-induced membrane tubulation regulates CD28 cluster stability and signalling Article Snippet: .. Briefly, Jurkat T cells were transfected with two guide RNAs designed using the GPP sgRNA Designer (https://portals. broadinstitute.org/gpp/public/analysis-tools/sgrna-design) to target exon 2: AATGAACTGACGGTTAATGA and exon 3: GAAACATCAAAGGAGAACGA of the SNX9 genomic DNA sequence, together with Article Title: SNX9-induced membrane tubulation regulates CD28 cluster stability and signalling Article Snippet: .. Briefly, Jurkat T cells were transfected with two guide RNAs designed using the GPP sgRNA Designer ( https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design ) to target exon 2: AATGAACTGACGGTTAATGA and exon 3: GAAACATCAAAGGAGAACGA of the SNX9 genomic DNA sequence, together with Clone Assay:Article Title: Pioneer activity distinguishes activating from non‐activating SOX2 binding sites Article Snippet: .. CRISP‐Cas9 and a sgRNA targeting the locus was cloned into a Article Title: Pioneer activity distinguishes activating from non-activating SOX2 binding sites. Article Snippet: .. CRISP-Cas9 and a sgRNA targeting the locus was cloned into a |
